Welcome to Linux Knowledge Base and Tutorial
"The place where you learn linux"
Cyber Angels

 Create an AccountHome | Submit News | Your Account  

Tutorial Menu
Linux Tutorial Home
Table of Contents

· Introduction to Operating Systems
· Linux Basics
· Working with the System
· Shells and Utilities
· Editing Files
· Basic Administration
· The Operating System
· The X Windowing System
· The Computer Itself
· Networking
· System Monitoring
· Solving Problems
· Security
· Installing and Upgrading
· Linux and Windows

Glossary
MoreInfo
Man Pages
Linux Topics
Test Your Knowledge

Site Menu
Site Map
FAQ
Copyright Info
Terms of Use
Privacy Info
Disclaimer
WorkBoard
Thanks
Donations
Advertising
Masthead / Impressum
Your Account

Communication
Feedback
Forums
Private Messages
Surveys

Features
HOWTOs
News Archive
Submit News
Topics
User Articles
Web Links

Google
Google


The Web
linux-tutorial.info

Who's Online
There are currently, 209 guest(s) and 0 member(s) that are online.

You are an Anonymous user. You can register for free by clicking here

  

perlretut



DESCRIPTION

       This page provides a basic tutorial on understanding, cre­
       ating and using regular expressions in Perl.  It serves as
       a complement to the reference page on regular expressions
       perlre.  Regular expressions are an integral part of the
       "m//", "s///", "qr//" and "split" operators and so this
       tutorial also overlaps with "Regexp Quote-Like Operators"
       in perlop and "split" in perlfunc.

       Perl is widely renowned for excellence in text processing,
       and regular expressions are one of the big factors behind
       this fame.  Perl regular expressions display an efficiency
       and flexibility unknown in most other computer languages.
       Mastering even the basics of regular expressions will
       allow you to manipulate text with surprising ease.

       What is a regular expression?  A regular expression is
       simply a string that describes a pattern.  Patterns are in
       common use these days; examples are the patterns typed
       into a search engine to find web pages and the patterns
       used to list files in a directory, e.g., "ls *.txt" or
       "dir *.*".  In Perl, the patterns described by regular
       expressions are used to search strings, extract desired
       parts of strings, and to do search and replace operations.

       Regular expressions have the undeserved reputation of
       being abstract and difficult to understand.  Regular
       expressions are constructed using simple concepts like
       conditionals and loops and are no more difficult to under­
       stand than the corresponding "if" conditionals and "while"
       loops in the Perl language itself.  In fact, the main
       challenge in learning regular expressions is just getting
       used to the terse notation used to express these concepts.

       This tutorial flattens the learning curve by discussing
       regular expression concepts, along with their notation,
       one at a time and with many examples.  The first part of
       the tutorial will progress from the simplest word searches
       to the basic regular expression concepts.  If you master
       the first part, you will have all the tools needed to
       solve about 98% of your needs.  The second part of the
       tutorial is for those comfortable with the basics and hun­
       gry for more power tools.  It discusses the more advanced
       regular expression operators and introduces the latest
       cutting edge innovations in 5.6.0.

       A note: to save time, 'regular expression' is often abbre­
       viated as regexp or regex.  Regexp is a more natural
       abbreviation than regex, but is harder to pronounce.  The
       Perl pod documentation is evenly split on regexp vs regex;
       in Perl, there is more than one way to abbreviate it.
       We'll use regexp in this tutorial.
       the string with the regexp match and produces a true value
       if the regexp matched, or false if the regexp did not
       match.  In our case, "World" matches the second word in
       "Hello World", so the expression is true.  Expressions
       like this are useful in conditionals:

           if ("Hello World" =~ /World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       There are useful variations on this theme.  The sense of
       the match can be reversed by using "!~" operator:

           if ("Hello World" !~ /World/) {
               print "It doesn't match\n";
           }
           else {
               print "It matches\n";
           }

       The literal string in the regexp can be replaced by a
       variable:

           $greeting = "World";
           if ("Hello World" =~ /$greeting/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       If you're matching against the special default variable
       $_, the "$_ =~" part can be omitted:

           $_ = "Hello World";
           if (/World/) {
               print "It matches\n";
           }
           else {
               print "It doesn't match\n";
           }

       And finally, the "//" default delimiters for a match can
       be changed to arbitrary delimiters by putting an 'm' out
       front:

           "Hello World" =~ m!World!;   # matches, delimited by '!'
           "Hello World" =~ m{World};   # matches, note the matching '{}'
           "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',

       The first regexp "world" doesn't match because regexps are
       case-sensitive.  The second regexp matches because the
       substring 'o W'  occurs in the string "Hello World" .  The
       space character ' ' is treated like any other character in
       a regexp and is needed to match in this case.  The lack of
       a space character is the reason the third regexp 'oW'
       doesn't match.  The fourth regexp 'World ' doesn't match
       because there is a space at the end of the regexp, but not
       at the end of the string.  The lesson here is that regexps
       must match a part of the string exactly in order for the
       statement to be true.

       If a regexp matches in more than one place in the string,
       perl will always match at the earliest possible point in
       the string:

           "Hello World" =~ /o/;       # matches 'o' in 'Hello'
           "That hat is red" =~ /hat/; # matches 'hat' in 'That'

       With respect to character matching, there are a few more
       points you need to know about.   First of all, not all
       characters can be used 'as is' in a match.  Some charac­
       ters, called metacharacters, are reserved for use in reg­
       exp notation.  The metacharacters are

           {}[]()^$.|*+?\

       The significance of each of these will be explained in the
       rest of the tutorial, but for now, it is important only to
       know that a metacharacter can be matched by putting a
       backslash before it:

           "2+2=4" =~ /2+2/;    # doesn't match, + is a metacharacter
           "2+2=4" =~ /2\+2/;   # matches, \+ is treated like an ordinary +
           "The interval is [0,1)." =~ /[0,1)./     # is a syntax error!
           "The interval is [0,1)." =~ /\[0,1\)\./  # matches
           "/usr/bin/perl" =~ /\/usr\/local\/bin\/perl/;  # matches

       In the last regexp, the forward slash '/' is also back­
       slashed, because it is used to delimit the regexp.  This
       can lead to LTS (leaning toothpick syndrome), however, and
       it is often more readable to change delimiters.

       The backslash character '\' is a metacharacter itself and
       needs to be backslashed:

           'C:\WIN32' =~ /C:\\WIN/;   # matches

       In addition to the metacharacters, there are some ASCII
       characters which don't have printable character equiva­
       lents and are instead represented by escape sequences.
       escape sequences may seem familiar.  Similar escape
       sequences are used in double-quoted strings and in fact
       the regexps in Perl are mostly treated as double-quoted
       strings.  This means that variables can be used in regexps
       as well.  Just like double-quoted strings, the values of
       the variables in the regexp will be substituted in before
       the regexp is evaluated for matching purposes.  So we
       have:

           $foo = 'house';
           'housecat' =~ /$foo/;      # matches
           'cathouse' =~ /cat$foo/;   # matches
           'housecat' =~ /${foo}cat/; # matches

       So far, so good.  With the knowledge above you can already
       perform searches with just about any literal string regexp
       you can dream up.  Here is a very simple emulation of the
       Unix grep program:

           % cat > simple_grep
           #!/usr/bin/perl
           $regexp = shift;
           while (<>) {
               print if /$regexp/;
           }
           ^D

           % chmod +x simple_grep

           % simple_grep abba /usr/dict/words
           Babbage
           cabbage
           cabbages
           sabbath
           Sabbathize
           Sabbathizes
           sabbatical
           scabbard
           scabbards

       This program is easy to understand.  "#!/usr/bin/perl" is
       the standard way to invoke a perl program from the shell.
       "$regexp = shift;"  saves the first command line argument
       as the regexp to be used, leaving the rest of the command
       line arguments to be treated as files.  "while (<>)"
       loops over all the lines in all the files.  For each line,
       "print if /$regexp/;"  prints the line if the regexp
       matches the line.  In this line, both "print" and "/$reg­
       exp/" use the default variable $_ implicitly.

       With all of the regexps above, if the regexp matched any­
       where in the string, it was considered a match.  Some­
       "housekeeper" has keeper starting in the middle.  The
       third regexp does match, since the "$" constrains "keeper"
       to match only at the end of the string.

       When both "^" and "$" are used at the same time, the reg­
       exp has to match both the beginning and the end of the
       string, i.e., the regexp matches the whole string.  Con­
       sider

           "keeper" =~ /^keep$/;      # doesn't match
           "keeper" =~ /^keeper$/;    # matches
           ""       =~ /^$/;          # ^$ matches an empty string

       The first regexp doesn't match because the string has more
       to it than "keep".  Since the second regexp is exactly the
       string, it matches.  Using both "^" and "$" in a regexp
       forces the complete string to match, so it gives you com­
       plete control over which strings match and which don't.
       Suppose you are looking for a fellow named bert, off in a
       string by himself:

           "dogbert" =~ /bert/;   # matches, but not what you want

           "dilbert" =~ /^bert/;  # doesn't match, but ..
           "bertram" =~ /^bert/;  # matches, so still not good enough

           "bertram" =~ /^bert$/; # doesn't match, good
           "dilbert" =~ /^bert$/; # doesn't match, good
           "bert"    =~ /^bert$/; # matches, perfect

       Of course, in the case of a literal string, one could just
       as easily use the string equivalence "$string eq 'bert'"
       and it would be more efficient.   The  "^...$" regexp
       really becomes useful when we add in the more powerful
       regexp tools below.

       Using character classes

       Although one can already do quite a lot with the literal
       string regexps above, we've only scratched the surface of
       regular expression technology.  In this and subsequent
       sections we will introduce regexp concepts (and associated
       metacharacter notations) that will allow a regexp to not
       just represent a single character sequence, but a whole
       class of them.

       One such concept is that of a character class.  A charac­
       ter class allows a set of possible characters, rather than
       just a single character, to match at a particular point in
       a regexp.  Character classes are denoted by brackets
       "[...]", with the set of characters to be possibly matched
       inside.  Here are some examples:
       This regexp displays a common task: perform a case-insen­
       sitive match.  Perl provides away of avoiding all those
       brackets by simply appending an 'i' to the end of the
       match.  Then "/[yY][eE][sS]/;" can be rewritten as
       "/yes/i;".  The 'i' stands for case-insensitive and is an
       example of a modifier of the matching operation.  We will
       meet other modifiers later in the tutorial.

       We saw in the section above that there were ordinary char­
       acters, which represented themselves, and special charac­
       ters, which needed a backslash "\" to represent them­
       selves.  The same is true in a character class, but the
       sets of ordinary and special characters inside a character
       class are different than those outside a character class.
       The special characters for a character class are "-]\^$".
       "]" is special because it denotes the end of a character
       class.  "$" is special because it denotes a scalar vari­
       able.  "\" is special because it is used in escape
       sequences, just like above.  Here is how the special char­
       acters "]$\" are handled:

          /[\]c]def/; # matches ']def' or 'cdef'
          $x = 'bcr';
          /[$x]at/;   # matches 'bat', 'cat', or 'rat'
          /[\$x]at/;  # matches '$at' or 'xat'
          /[\\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'

       The last two are a little tricky.  in "[\$x]", the back­
       slash protects the dollar sign, so the character class has
       two members "$" and "x".  In "[\\$x]", the backslash is
       protected, so $x is treated as a variable and substituted
       in double quote fashion.

       The special character '-' acts as a range operator within
       character classes, so that a contiguous set of characters
       can be written as a range.  With ranges, the unwieldy
       "[0123456789]" and "[abc...xyz]" become the svelte "[0-9]"
       and "[a-z]".  Some examples are

           /item[0-9]/;  # matches 'item0' or ... or 'item9'
           /[0-9bx-z]aa/;  # matches '0aa', ..., '9aa',
                           # 'baa', 'xaa', 'yaa', or 'zaa'
           /[0-9a-fA-F]/;  # matches a hexadecimal digit
           /[0-9a-zA-Z_]/; # matches a "word" character,
                           # like those in a perl variable name

       If '-' is the first or last character in a character
       class, it is treated as an ordinary character; "[-ab]",
       "[ab-]" and "[a\-b]" are all equivalent.

       The special character "^" in the first position of a char­
       acter class denotes a negated character class, which
       regexps more readable, Perl has several abbreviations for
       common character classes:

       ·   \d is a digit and represents [0-9]

       ·   \s is a whitespace character and represents [\
           \t\r\n\f]

       ·   \w is a word character (alphanumeric or _) and repre­
           sents [0-9a-zA-Z_]

       ·   \D is a negated \d; it represents any character but a
           digit [^0-9]

       ·   \S is a negated \s; it represents any non-whitespace
           character [^\s]

       ·   \W is a negated \w; it represents any non-word charac­
           ter [^\w]

       ·   The period '.' matches any character but "\n"

       The "\d\s\w\D\S\W" abbreviations can be used both inside
       and outside of character classes.  Here are some in use:

           /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
           /[\d\s]/;         # matches any digit or whitespace character
           /\w\W\w/;         # matches a word char, followed by a
                             # non-word char, followed by a word char
           /..rt/;           # matches any two chars, followed by 'rt'
           /end\./;          # matches 'end.'
           /end[.]/;         # same thing, matches 'end.'

       Because a period is a metacharacter, it needs to be
       escaped to match as an ordinary period. Because, for exam­
       ple, "\d" and "\w" are sets of characters, it is incorrect
       to think of "[^\d\w]" as "[\D\W]"; in fact "[^\d\w]" is
       the same as "[^\w]", which is the same as "[\W]". Think
       DeMorgan's laws.

       An anchor useful in basic regexps is the word anchor
       "\b".  This matches a boundary between a word character
       and a non-word character "\w\W" or "\W\w":

           $x = "Housecat catenates house and cat";
           $x =~ /cat/;    # matches cat in 'housecat'
           $x =~ /\bcat/;  # matches cat in 'catenates'
           $x =~ /cat\b/;  # matches cat in 'housecat'
           $x =~ /\bcat\b/;  # matches 'cat' at end of string

       Note in the last example, the end of the string is consid­
       ered a word boundary.
           "a"  =~ /^.$/;    # matches
           "a\n"  =~ /^.$/;  # matches, ignores the "\n"

       This behavior is convenient, because we usually want to
       ignore newlines when we count and match characters in a
       line.  Sometimes, however, we want to keep track of new­
       lines.  We might even want "^" and "$" to anchor at the
       beginning and end of lines within the string, rather than
       just the beginning and end of the string.  Perl allows us
       to choose between ignoring and paying attention to new­
       lines by using the "//s" and "//m" modifiers.  "//s" and
       "//m" stand for single line and multi-line and they deter­
       mine whether a string is to be treated as one continuous
       string, or as a set of lines.  The two modifiers affect
       two aspects of how the regexp is interpreted: 1) how the
       '.' character class is defined, and 2) where the anchors
       "^" and "$" are able to match.  Here are the four possible
       combinations:

       ·   no modifiers (//): Default behavior.  '.' matches any
           character except "\n".  "^" matches only at the begin­
           ning of the string and "$" matches only at the end or
           before a newline at the end.

       ·   s modifier (//s): Treat string as a single long line.
           '.' matches any character, even "\n".  "^" matches
           only at the beginning of the string and "$" matches
           only at the end or before a newline at the end.

       ·   m modifier (//m): Treat string as a set of multiple
           lines.  '.'  matches any character except "\n".  "^"
           and "$" are able to match at the start or end of any
           line within the string.

       ·   both s and m modifiers (//sm): Treat string as a sin­
           gle long line, but detect multiple lines.  '.' matches
           any character, even "\n".  "^" and "$", however, are
           able to match at the start or end of any line within
           the string.

       Here are examples of "//s" and "//m" in action:

           $x = "There once was a girl\nWho programmed in Perl\n";

           $x =~ /^Who/;   # doesn't match, "Who" not at start of string
           $x =~ /^Who/s;  # doesn't match, "Who" not at start of string
           $x =~ /^Who/m;  # matches, "Who" at start of second line
           $x =~ /^Who/sm; # matches, "Who" at start of second line

           $x =~ /girl.Who/;   # doesn't match, "." doesn't match "\n"
           $x =~ /girl.Who/s;  # matches, "." matches "\n"
           $x =~ /girl.Who/m;  # doesn't match, "." doesn't match "\n"
           $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string

           $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
           $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string

       We now know how to create choices among classes of charac­
       ters in a regexp.  What about choices among words or char­
       acter strings? Such choices are described in the next sec­
       tion.

       Matching this or that

       Sometimes we would like to our regexp to be able to match
       different possible words or character strings.  This is
       accomplished by using the alternation metacharacter "|".
       To match "dog" or "cat", we form the regexp "dog|cat".  As
       before, perl will try to match the regexp at the earliest
       possible point in the string.  At each character position,
       perl will first try to match the first alternative, "dog".
       If "dog" doesn't match, perl will then try the next alter­
       native, "cat".  If "cat" doesn't match either, then the
       match fails and perl moves to the next position in the
       string.  Some examples:

           "cats and dogs" =~ /cat|dog|bird/;  # matches "cat"
           "cats and dogs" =~ /dog|cat|bird/;  # matches "cat"

       Even though "dog" is the first alternative in the second
       regexp, "cat" is able to match earlier in the string.

           "cats"          =~ /c|ca|cat|cats/; # matches "c"
           "cats"          =~ /cats|cat|ca|c/; # matches "cats"

       Here, all the alternatives match at the first string posi­
       tion, so the first alternative is the one that matches.
       If some of the alternatives are truncations of the others,
       put the longest ones first to give them a chance to match.

           "cab" =~ /a|b|c/ # matches "c"
                            # /a|b|c/ == /[abc]/

       The last example points out that character classes are
       like alternations of characters.  At a given character
       position, the first alternative that allows the regexp
       match to succeed will be the one that matches.

       Grouping things and hierarchical matching

       Alternation allows a regexp to choose among alternatives,
       but by itself it unsatisfying.  The reason is that each
       alternative is a whole regexp, but sometime we want alter­
       natives for just part of a regexp.  For instance, suppose

           /(a|b)b/;    # matches 'ab' or 'bb'
           /(ac|b)b/;   # matches 'acb' or 'bb'
           /(^a|b)c/;   # matches 'ac' at start of string or 'bc' anywhere
           /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'

           /house(cat|)/;  # matches either 'housecat' or 'house'
           /house(cat(s|)|)/;  # matches either 'housecats' or 'housecat' or
                               # 'house'.  Note groups can be nested.

           /(19|20|)\d\d/;  # match years 19xx, 20xx, or the Y2K problem, xx
           "20" =~ /(19|20|)\d\d/;  # matches the null alternative '()\d\d',
                                    # because '20\d\d' can't match

       Alternations behave the same way in groups as out of them:
       at a given string position, the leftmost alternative that
       allows the regexp to match is taken.  So in the last exam­
       ple at the first string position, "20" matches the second
       alternative, but there is nothing left over to match the
       next two digits "\d\d".  So perl moves on to the next
       alternative, which is the null alternative and that works,
       since "20" is two digits.

       The process of trying one alternative, seeing if it
       matches, and moving on to the next alternative if it
       doesn't, is called backtracking.  The term 'backtracking'
       comes from the idea that matching a regexp is like a walk
       in the woods.  Successfully matching a regexp is like
       arriving at a destination.  There are many possible trail­
       heads, one for each string position, and each one is tried
       in order, left to right.  From each trailhead there may be
       many paths, some of which get you there, and some which
       are dead ends.  When you walk along a trail and hit a dead
       end, you have to backtrack along the trail to an earlier
       point to try another trail.  If you hit your destination,
       you stop immediately and forget about trying all the other
       trails.  You are persistent, and only if you have tried
       all the trails from all the trailheads and not arrived at
       your destination, do you declare failure.  To be concrete,
       here is a step-by-step analysis of what perl does when it
       tries to match the regexp

           "abcde" =~ /(abd|abc)(df|d|de)/;

       0   Start with the first letter in the string 'a'.

       1   Try the first alternative in the first group 'abd'.

       2   Match 'a' followed by 'b'. So far so good.

       3   'd' in the regexp doesn't match 'c' in the string - a
           dead end.  So backtrack two characters and pick the

       8   'd' matches. The second grouping is satisfied, so set
           $2 to 'd'.

       9   We are at the end of the regexp, so we are done! We
           have matched 'abcd' out of the string "abcde".

       There are a couple of things to note about this analysis.
       First, the third alternative in the second group 'de' also
       allows a match, but we stopped before we got to it - at a
       given character position, leftmost wins.  Second, we were
       able to get a match at the first character position of the
       string 'a'.  If there were no matches at the first posi­
       tion, perl would move to the second character position 'b'
       and attempt the match all over again.  Only when all pos­
       sible paths at all possible character positions have been
       exhausted does perl give up and declare
       "$string =~ /(abd|abc)(df|d|de)/;"  to be false.

       Even with all this work, regexp matching happens remark­
       ably fast.  To speed things up, during compilation stage,
       perl compiles the regexp into a compact sequence of
       opcodes that can often fit inside a processor cache.  When
       the code is executed, these opcodes can then run at full
       throttle and search very quickly.

       Extracting matches

       The grouping metacharacters "()" also serve another com­
       pletely different function: they allow the extraction of
       the parts of a string that matched.  This is very useful
       to find out what matched and for text processing in gen­
       eral.  For each grouping, the part that matched inside
       goes into the special variables $1, $2, etc.  They can be
       used just as ordinary variables:

           # extract hours, minutes, seconds
           if ($time =~ /(\d\d):(\d\d):(\d\d)/) {    # match hh:mm:ss format
               $hours = $1;
               $minutes = $2;
               $seconds = $3;
           }

       Now, we know that in scalar context,
       "$time =~ /(\d\d):(\d\d):(\d\d)/"  returns a true or false
       value.  In list context, however, it returns the list of
       matched values "($1,$2,$3)".  So we could write the code
       more compactly as

           # extract hours, minutes, seconds
           ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);

       match).

       Closely associated with the matching variables $1, $2, ...
       are the backreferences "\1", "\2", ... .  Backreferences
       are simply matching variables that can be used inside a
       regexp.  This is a really nice feature - what matches
       later in a regexp can depend on what matched earlier in
       the regexp.  Suppose we wanted to look for doubled words
       in text, like 'the the'.  The following regexp finds all
       3-letter doubles with a space in between:

           /(\w\w\w)\s\1/;

       The grouping assigns a value to \1, so that the same 3
       letter sequence is used for both parts.  Here are some
       words with repeated parts:

           % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\1$' /usr/dict/words
           beriberi
           booboo
           coco
           mama
           murmur
           papa

       The regexp has a single grouping which considers 4-letter
       combinations, then 3-letter combinations, etc.  and uses
       "\1" to look for a repeat.  Although $1 and "\1" represent
       the same thing, care should be taken to use matched vari­
       ables $1, $2, ... only outside a regexp and backreferences
       "\1", "\2", ... only inside a regexp; not doing so may
       lead to surprising and/or undefined results.

       In addition to what was matched, Perl 5.6.0 also provides
       the positions of what was matched with the "@-" and "@+"
       arrays. "$-[0]" is the position of the start of the entire
       match and $+[0] is the position of the end. Similarly,
       "$-[n]" is the position of the start of the $n match and
       $+[n] is the position of the end. If $n is undefined, so
       are "$-[n]" and $+[n]. Then this code

           $x = "Mmm...donut, thought Homer";
           $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
           foreach $expr (1..$#-) {
               print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
           }

       prints

           Match 1: 'Mmm' at position (0,3)
           Match 2: 'donut' at position (6,11)

       that using $` and $' slows down regexp matching quite a
       bit, and  $&  slows it down to a lesser extent, because if
       they are used in one regexp in a program, they are gener­
       ated for <all> regexps in the program.  So if raw perfor­
       mance is a goal of your application, they should be
       avoided.  If you need them, use "@-" and "@+" instead:

           $` is the same as substr( $x, 0, $-[0] )
           $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
           $' is the same as substr( $x, $+[0] )

       Matching repetitions

       The examples in the previous section display an annoying
       weakness.  We were only matching 3-letter words, or sylla­
       bles of 4 letters or less.  We'd like to be able to match
       words or syllables of any length, without writing out
       tedious alternatives like "\w\w\w\w|\w\w\w|\w\w|\w".

       This is exactly the problem the quantifier metacharacters
       "?", "*", "+", and "{}" were created for.  They allow us
       to determine the number of repeats of a portion of a reg­
       exp we consider to be a match.  Quantifiers are put imme­
       diately after the character, character class, or grouping
       that we want to specify.  They have the following mean­
       ings:

       ·   "a?" = match 'a' 1 or 0 times

       ·   "a*" = match 'a' 0 or more times, i.e., any number of
           times

       ·   "a+" = match 'a' 1 or more times, i.e., at least once

       ·   "a{n,m}" = match at least "n" times, but not more than
           "m" times.

       ·   "a{n,}" = match at least "n" or more times

       ·   "a{n}" = match exactly "n" times

       Here are some examples:

           /[a-z]+\s+\d*/;  # match a lowercase word, at least some space, and
                            # any number of digits
           /(\w+)\s+\1/;    # match doubled words of arbitrary length
           /y(es)?/i;       # matches 'y', 'Y', or a case-insensitive 'yes'
           $year =~ /\d{2,4}/;  # make sure year is at least 2 but not more
                                # than 4 digits
           $year =~ /\d{4}|\d{2}/;    # better match; throw out 3 digit dates
           $year =~ /\d{2}(\d{2})?/;  # same thing written differently. However,
                                      # this produces $1 and the other does not.

       For all of these quantifiers, perl will try to match as
       much of the string as possible, while still allowing the
       regexp to succeed.  Thus with "/a?.../", perl will first
       try to match the regexp with the "a" present; if that
       fails, perl will try to match the regexp without the "a"
       present.  For the quantifier "*", we get the following:

           $x = "the cat in the hat";
           $x =~ /^(.*)(cat)(.*)$/; # matches,
                                    # $1 = 'the '
                                    # $2 = 'cat'
                                    # $3 = ' in the hat'

       Which is what we might expect, the match finds the only
       "cat" in the string and locks onto it.  Consider, however,
       this regexp:

           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       One might initially guess that perl would find the "at" in
       "cat" and stop there, but that wouldn't give the longest
       possible string to the first quantifier ".*".  Instead,
       the first quantifier ".*" grabs as much of the string as
       possible while still having the regexp match.  In this
       example, that means having the "at" sequence with the
       final "at" in the string.  The other important principle
       illustrated here is that when there are two or more ele­
       ments in a regexp, the leftmost quantifier, if there is
       one, gets to grab as much the string as possible, leaving
       the rest of the regexp to fight over scraps.  Thus in our
       example, the first quantifier ".*" grabs most of the
       string, while the second quantifier ".*" gets the empty
       string.   Quantifiers that grab as much of the string as
       possible are called maximal match or greedy quantifiers.

       When a regexp can match a string in several different
       ways, we can use the principles above to predict which way
       the regexp will match:

       ·   Principle 0: Taken as a whole, any regexp will be
           matched at the earliest possible position in the
           string.

       ·   Principle 1: In an alternation "a|b|c...", the left­
           most alternative that allows a match for the whole
           regexp will be the one used.

       ·   Principle 2: The maximal matching quantifiers "?",
       the regexp will be matched as early as possible, with the
       other principles determining how the regexp matches at
       that earliest character position.

       Here is an example of these principles in action:

           $x = "The programming republic of Perl";
           $x =~ /^(.+)(e|r)(.*)$/;  # matches,
                                     # $1 = 'The programming republic of Pe'
                                     # $2 = 'r'
                                     # $3 = 'l'

       This regexp matches at the earliest string position, 'T'.
       One might think that "e", being leftmost in the alterna­
       tion, would be matched, but "r" produces the longest
       string in the first quantifier.

           $x =~ /(m{1,2})(.*)$/;  # matches,
                                   # $1 = 'mm'
                                   # $2 = 'ing republic of Perl'

       Here, The earliest possible match is at the first 'm' in
       "programming". "m{1,2}" is the first quantifier, so it
       gets to match a maximal "mm".

           $x =~ /.*(m{1,2})(.*)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ing republic of Perl'

       Here, the regexp matches at the start of the string. The
       first quantifier ".*" grabs as much as possible, leaving
       just a single 'm' for the second quantifier "m{1,2}".

           $x =~ /(.?)(m{1,2})(.*)$/;  # matches,
                                       # $1 = 'a'
                                       # $2 = 'mm'
                                       # $3 = 'ing republic of Perl'

       Here, ".?" eats its maximal one character at the earliest
       possible position in the string, 'a' in "programming",
       leaving "m{1,2}" the opportunity to match both "m"'s.
       Finally,

           "aXXXb" =~ /(X*)/; # matches with $1 = ''

       because it can match zero copies of 'X' at the beginning
       of the string.  If you definitely want to match at least
       one 'X', use "X+", not "X*".

       Sometimes greed is not good.  At times, we would like
       quantifiers to match a minimal piece of string, rather
       than a maximal piece.  For this purpose, Larry Wall cre­
           "m" times, as few times as possible

       ·   "a{n,}?" = match at least "n" times, but as few times
           as possible

       ·   "a{n}?" = match exactly "n" times.  Because we match
           exactly "n" times, "a{n}?" is equivalent to "a{n}" and
           is just there for notational consistency.

       Let's look at the example above, but with minimal quanti­
       fiers:

           $x = "The programming republic of Perl";
           $x =~ /^(.+?)(e|r)(.*)$/; # matches,
                                     # $1 = 'Th'
                                     # $2 = 'e'
                                     # $3 = ' programming republic of Perl'

       The minimal string that will allow both the start of the
       string "^" and the alternation to match is "Th", with the
       alternation "e|r" matching "e".  The second quantifier
       ".*" is free to gobble up the rest of the string.

           $x =~ /(m{1,2}?)(.*?)$/;  # matches,
                                     # $1 = 'm'
                                     # $2 = 'ming republic of Perl'

       The first string position that this regexp can match is at
       the first 'm' in "programming". At this position, the min­
       imal "m{1,2}?"  matches just one 'm'.  Although the second
       quantifier ".*?" would prefer to match no characters, it
       is constrained by the end-of-string anchor "$" to match
       the rest of the string.

           $x =~ /(.*?)(m{1,2}?)(.*)$/;  # matches,
                                         # $1 = 'The progra'
                                         # $2 = 'm'
                                         # $3 = 'ming republic of Perl'

       In this regexp, you might expect the first minimal quanti­
       fier ".*?"  to match the empty string, because it is not
       constrained by a "^" anchor to match the beginning of the
       word.  Principle 0 applies here, however.  Because it is
       possible for the whole regexp to match at the start of the
       string, it will match at the start of the string.  Thus
       the first quantifier has to match everything up to the
       first "m".  The second minimal quantifier matches just one
       "m" and the third quantifier matches the rest of the
       string.

           $x =~ /(.??)(m{1,2})(.*)$/;  # matches,
                                        # $1 = 'a'

           possible while still allowing the whole regexp to
           match.  The next leftmost greedy (non-greedy) quanti­
           fier, if any, will try to match as much (little) of
           the string remaining available to it as possible,
           while still allowing the whole regexp to match.  And
           so on, until all the regexp elements are satisfied.

       Just like alternation, quantifiers are also susceptible to
       backtracking.  Here is a step-by-step analysis of the
       example

           $x = "the cat in the hat";
           $x =~ /^(.*)(at)(.*)$/; # matches,
                                   # $1 = 'the cat in the h'
                                   # $2 = 'at'
                                   # $3 = ''   (0 matches)

       0   Start with the first letter in the string 't'.

       1   The first quantifier '.*' starts out by matching the
           whole string 'the cat in the hat'.

       2   'a' in the regexp element 'at' doesn't match the end
           of the string.  Backtrack one character.

       3   'a' in the regexp element 'at' still doesn't match the
           last letter of the string 't', so backtrack one more
           character.

       4   Now we can match the 'a' and the 't'.

       5   Move on to the third element '.*'.  Since we are at
           the end of the string and '.*' can match 0 times,
           assign it the empty string.

       6   We are done!

       Most of the time, all this moving forward and backtracking
       happens quickly and searching is fast.   There are some
       pathological regexps, however, whose execution time expo­
       nentially grows with the size of the string.  A typical
       structure that blows up in your face is of the form

           /(a|b+)*/;

       The problem is the nested indeterminate quantifiers.
       There are many different ways of partitioning a string of
       length n between the "+" and "*": one repetition with "b+"
       of length n, two repetitions with the first "b+" length k
       and the second with length n-k, m repetitions whose bits
       add up to length n, etc.  In fact there are an exponential
       number of ways to partition a string as a function of
       The first task in building a regexp is to decide what we
       want to match and what we want to exclude.  In our case,
       we want to match both integers and floating point numbers
       and we want to reject any string that isn't a number.

       The next task is to break the problem down into smaller
       problems that are easily converted into a regexp.

       The simplest case is integers.  These consist of a
       sequence of digits, with an optional sign in front.  The
       digits we can represent with "\d+" and the sign can be
       matched with "[+-]".  Thus the integer regexp is

           /[+-]?\d+/;  # matches integers

       A floating point number potentially has a sign, an inte­
       gral part, a decimal point, a fractional part, and an
       exponent.  One or more of these parts is optional, so we
       need to check out the different possibilities.  Floating
       point numbers which are in proper form include 123.,
       0.345, .34, -1e6, and 25.4E-72.  As with integers, the
       sign out front is completely optional and can be matched
       by "[+-]?".  We can see that if there is no exponent,
       floating point numbers must have a decimal point, other­
       wise they are integers.  We might be tempted to model
       these with "\d*\.\d*", but this would also match just a
       single decimal point, which is not a number.  So the three
       cases of floating point number sans exponent are

          /[+-]?\d+\./;  # 1., 321., etc.
          /[+-]?\.\d+/;  # .1, .234, etc.
          /[+-]?\d+\.\d+/;  # 1.0, 30.56, etc.

       These can be combined into a single regexp with a three-
       way alternation:

          /[+-]?(\d+\.\d+|\d+\.|\.\d+)/;  # floating point, no exponent

       In this alternation, it is important to put '\d+\.\d+'
       before '\d+\.'.  If '\d+\.' were first, the regexp would
       happily match that and ignore the fractional part of the
       number.

       Now consider floating point numbers with exponents.  The
       key observation here is that both integers and numbers
       with decimal points are allowed in front of an exponent.
       Then exponents, like the overall sign, are independent of
       whether we are matching numbers with or without decimal
       points, and can be 'decoupled' from the mantissa.  The
       overall form of the regexp now becomes clear:

           /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;

       to put nearly arbitrary whitespace and comments into a
       regexp without affecting their meaning.  Using it, we can
       rewrite our 'extended' regexp in the more pleasing form

          /^
             [+-]?         # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;

       If whitespace is mostly irrelevant, how does one include
       space characters in an extended regexp? The answer is to
       backslash it '\ '  or put it in a character class "[ ]" .
       The same thing goes for pound signs, use "\#" or "[#]".
       For instance, Perl allows a space between the sign and the
       mantissa/integer, and we could add this to our regexp as
       follows:

          /^
             [+-]?\ *      # first, match an optional sign *and space*
             (             # then match integers or f.p. mantissas:
                 \d+\.\d+  # mantissa of the form a.b
                |\d+\.     # mantissa of the form a.
                |\.\d+     # mantissa of the form .b
                |\d+       # integer of the form a
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;

       In this form, it is easier to see a way to simplify the
       alternation.  Alternatives 1, 2, and 4 all start with
       "\d+", so it could be factored out:

          /^
             [+-]?\ *      # first, match an optional sign
             (             # then match integers or f.p. mantissas:
                 \d+       # start out with a ...
                 (
                     \.\d* # mantissa of the form a.b or a.
                 )?        # ? takes care of integers of the form a
                |\.\d+     # mantissa of the form .b
             )
             ([eE][+-]?\d+)?  # finally, optionally match an exponent
          $/x;

       or written in the compact form,

       These are also the typical steps involved in writing a
       computer program.  This makes perfect sense, because regu­
       lar expressions are essentially programs written a little
       computer language that specifies patterns.

       Using regular expressions in Perl

       The last topic of Part 1 briefly covers how regexps are
       used in Perl programs.  Where do they fit into Perl syn­
       tax?

       We have already introduced the matching operator in its
       default "/regexp/" and arbitrary delimiter "m!regexp!"
       forms.  We have used the binding operator "=~" and its
       negation "!~" to test for string matches.  Associated with
       the matching operator, we have discussed the single line
       "//s", multi-line "//m", case-insensitive "//i" and
       extended "//x" modifiers.

       There are a few more things you might want to know about
       matching operators.  First, we pointed out earlier that
       variables in regexps are substituted before the regexp is
       evaluated:

           $pattern = 'Seuss';
           while (<>) {
               print if /$pattern/;
           }

       This will print any lines containing the word "Seuss".  It
       is not as efficient as it could be, however, because perl
       has to re-evaluate $pattern each time through the loop.
       If $pattern won't be changing over the lifetime of the
       script, we can add the "//o" modifier, which directs perl
       to only perform variable substitutions once:

           #!/usr/bin/perl
           #    Improved simple_grep
           $regexp = shift;
           while (<>) {
               print if /$regexp/o;  # a good deal faster
           }

       If you change $pattern after the first substitution hap­
       pens, perl will ignore it.  If you don't want any substi­
       tutions at all, use the special delimiter "m''":

           $pattern = 'Seuss';
           while (<>) {
               print if m'$pattern';  # matches '$pattern', not 'Seuss'
           }

       it goes along.  You can get or set the position with the
       "pos()" function.

       The use of "//g" is shown in the following example.  Sup­
       pose we have a string that consists of words separated by
       spaces.  If we know how many words there are in advance,
       we could extract the words using groupings:

           $x = "cat dog house"; # 3 words
           $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
                                                  # $1 = 'cat'
                                                  # $2 = 'dog'
                                                  # $3 = 'house'

       But what if we had an indeterminate number of words? This
       is the sort of task "//g" was made for.  To extract all
       words, form the simple regexp "(\w+)" and loop over all
       matches with "/(\w+)/g":

           while ($x =~ /(\w+)/g) {
               print "Word is $1, ends at position ", pos $x, "\n";
           }

       prints

           Word is cat, ends at position 3
           Word is dog, ends at position 7
           Word is house, ends at position 13

       A failed match or changing the target string resets the
       position.  If you don't want the position reset after
       failure to match, add the "//c", as in "/regexp/gc".  The
       current position in the string is associated with the
       string, not the regexp.  This means that different strings
       have different positions and their respective positions
       can be set or read independently.

       In list context, "//g" returns a list of matched group­
       ings, or if there are no groupings, a list of matches to
       the whole regexp.  So if we wanted just the words, we
       could use

           @words = ($x =~ /(\w+)/g);  # matches,
                                       # $word[0] = 'cat'
                                       # $word[1] = 'dog'
                                       # $word[2] = 'house'

       Closely associated with the "//g" modifier is the "\G"
       anchor.  The "\G" anchor matches at the point where the
       previous "//g" match left off.  "\G" allows us to easily
       do context-sensitive matching:

           }
           else {
               print "Units error!" unless $x =~ /\Glbs\./g;
           }
           $x =~ /\G\s+(widget|sprocket)/g;  # continue processing

       The combination of "//g" and "\G" allows us to process the
       string a bit at a time and use arbitrary Perl logic to
       decide what to do next.  Currently, the "\G" anchor is
       only fully supported when used to anchor to the start of
       the pattern.

       "\G" is also invaluable in processing fixed length records
       with regexps.  Suppose we have a snippet of coding region
       DNA, encoded as base pair letters "ATCGTTGAAT..." and we
       want to find all the stop codons "TGA".  In a coding
       region, codons are 3-letter sequences, so we can think of
       the DNA snippet as a sequence of 3-letter records.  The
       naive regexp

           # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
           $dna = "ATCGTTGAATGCAAATGACATGAC";
           $dna =~ /TGA/;

       doesn't work; it may match a "TGA", but there is no guar­
       antee that the match is aligned with codon boundaries,
       e.g., the substring "GTT GAA"  gives a match.  A better
       solution is

           while ($dna =~ /(\w\w\w)*?TGA/g) {  # note the minimal *?
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       which prints

           Got a TGA stop codon at position 18
           Got a TGA stop codon at position 23

       Position 18 is good, but position 23 is bogus.  What hap­
       pened?

       The answer is that our regexp works well until we get past
       the last real match.  Then the regexp will fail to match a
       synchronized "TGA" and start stepping ahead one character
       position at a time, not what we want.  The solution is to
       use "\G" to anchor the match to the codon alignment:

           while ($dna =~ /\G(\w\w\w)*?TGA/g) {
               print "Got a TGA stop codon at position ", pos $dna, "\n";
           }

       This prints
       The "replacement" is a Perl double quoted string that
       replaces in the string whatever is matched with the "reg­
       exp".  The operator "=~" is also used here to associate a
       string with "s///".  If matching against $_, the "$_ =~"
       can be dropped.  If there is a match, "s///" returns the
       number of substitutions made, otherwise it returns false.
       Here are a few examples:

           $x = "Time to feed the cat!";
           $x =~ s/cat/hacker/;   # $x contains "Time to feed the hacker!"
           if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
               $more_insistent = 1;
           }
           $y = "'quoted words'";
           $y =~ s/^'(.*)'$/$1/;  # strip single quotes,
                                  # $y contains "quoted words"

       In the last example, the whole string was matched, but
       only the part inside the single quotes was grouped.  With
       the "s///" operator, the matched variables $1, $2, etc.
       are immediately available for use in the replacement
       expression, so we use $1 to replace the quoted string with
       just what was quoted.  With the global modifier, "s///g"
       will search and replace all occurrences of the regexp in
       the string:

           $x = "I batted 4 for 4";
           $x =~ s/4/four/;   # doesn't do it all:
                              # $x contains "I batted four for 4"
           $x = "I batted 4 for 4";
           $x =~ s/4/four/g;  # does it all:
                              # $x contains "I batted four for four"

       If you prefer 'regex' over 'regexp' in this tutorial, you
       could use the following program to replace it:

           % cat > simple_replace
           #!/usr/bin/perl
           $regexp = shift;
           $replacement = shift;
           while (<>) {
               s/$regexp/$replacement/go;
               print;
           }
           ^D

           % simple_replace regexp regex perlretut.pod

       In "simple_replace" we used the "s///g" modifier to
       replace all occurrences of the regexp on each line and the
       "s///o" modifier to compile the regexp only once.  As with
       "simple_grep", both the "print" and the "s/$reg­

       This prints

           frequency of ' ' is 2
           frequency of 't' is 2
           frequency of 'l' is 2
           frequency of 'B' is 1
           frequency of 'c' is 1
           frequency of 'e' is 1
           frequency of 'h' is 1
           frequency of 'i' is 1
           frequency of 'a' is 1

       As with the match "m//" operator, "s///" can use other
       delimiters, such as "s!!!" and "s{}{}", and even "s{}//".
       If single quotes are used "s'''", then the regexp and
       replacement are treated as single quoted strings and there
       are no substitutions.  "s///" in list context returns the
       same thing as in scalar context, i.e., the number of
       matches.

       The split operator

       The "split"  function can also optionally use a matching
       operator "m//" to split a string.  "split /regexp/,
       string, limit" splits "string" into a list of substrings
       and returns that list.  The regexp is used to match the
       character sequence that the "string" is split with respect
       to.  The "limit", if present, constrains splitting into no
       more than "limit" number of strings.  For example, to
       split a string into words, use

           $x = "Calvin and Hobbes";
           @words = split /\s+/, $x;  # $word[0] = 'Calvin'
                                      # $word[1] = 'and'
                                      # $word[2] = 'Hobbes'

       If the empty regexp "//" is used, the regexp always
       matches and the string is split into individual charac­
       ters.  If the regexp has groupings, then list produced
       contains the matched substrings from the groupings as
       well.  For instance,

           $x = "/usr/bin/perl";
           @dirs = split m!/!, $x;  # $dirs[0] = ''
                                    # $dirs[1] = 'usr'
                                    # $dirs[2] = 'bin'
                                    # $dirs[3] = 'perl'
           @parts = split m!(/)!, $x;  # $parts[0] = ''
                                       # $parts[1] = '/'
                                       # $parts[2] = 'usr'
                                       # $parts[3] = '/'


Part 2: Power tools

       OK, you know the basics of regexps and you want to know
       more.  If matching regular expressions is analogous to a
       walk in the woods, then the tools discussed in Part 1 are
       analogous to topo maps and a compass, basic tools we use
       all the time.  Most of the tools in part 2 are analogous
       to flare guns and satellite phones.  They aren't used too
       often on a hike, but when we are stuck, they can be
       invaluable.

       What follows are the more advanced, less used, or some­
       times esoteric capabilities of perl regexps.  In Part 2,
       we will assume you are comfortable with the basics and
       concentrate on the new features.

       More on characters, strings, and character classes

       There are a number of escape sequences and character
       classes that we haven't covered yet.

       There are several escape sequences that convert characters
       or strings between upper and lower case.  "\l" and "\u"
       convert the next character to lower or upper case, respec­
       tively:

           $x = "perl";
           $string =~ /\u$x/;  # matches 'Perl' in $string
           $x = "M(rs?|s)\\."; # note the double backslash
           $string =~ /\l$x/;  # matches 'mr.', 'mrs.', and 'ms.',

       "\L" and "\U" converts a whole substring, delimited by
       "\L" or "\U" and "\E", to lower or upper case:

           $x = "This word is in lower case:\L SHOUT\E";
           $x =~ /shout/;       # matches
           $x = "I STILL KEYPUNCH CARDS FOR MY 360"
           $x =~ /\Ukeypunch/;  # matches punch card string

       If there is no "\E", case is converted until the end of
       the string. The regexps "\L\u$word" or "\u\L$word" convert
       the first character of $word to uppercase and the rest of
       the characters to lowercase.

       Control characters can be escaped with "\c", so that a
       control-Z character would be matched with "\cZ".  The
       escape sequence "\Q"..."\E" quotes, or protects most non-
       alphabetic characters.   For instance,

           $x = "\QThat !^*&%~& cat!";
           $x =~ /\Q!^*&%~&\E/;  # check for rough language

       strings.  But they do need to know 1) how to represent
       Unicode characters in a regexp and 2) when a matching
       operation will treat the string to be searched as a
       sequence of bytes (the old way) or as a sequence of Uni­
       code characters (the new way).  The answer to 1) is that
       Unicode characters greater than "chr(127)" may be repre­
       sented using the "\x{hex}" notation, with "hex" a hexadec­
       imal integer:

           /\x{263a}/;  # match a Unicode smiley face :)

       Unicode characters in the range of 128-255 use two hex­
       adecimal digits with braces: "\x{ab}".  Note that this is
       different than "\xab", which is just a hexadecimal byte
       with no Unicode significance.

       NOTE: in Perl 5.6.0 it used to be that one needed to say
       "use utf8" to use any Unicode features.  This is no more
       the case: for almost all Unicode processing, the explicit
       "utf8" pragma is not needed.  (The only case where it mat­
       ters is if your Perl script is in Unicode and encoded in
       UTF-8, then an explicit "use utf8" is needed.)

       Figuring out the hexadecimal sequence of a Unicode charac­
       ter you want or deciphering someone else's hexadecimal
       Unicode regexp is about as much fun as programming in
       machine code.  So another way to specify Unicode charac­
       ters is to use the named character  escape sequence
       "\N{name}".  "name" is a name for the Unicode character,
       as specified in the Unicode standard.  For instance, if we
       wanted to represent or match the astrological sign for the
       planet Mercury, we could use

           use charnames ":full"; # use named chars with Unicode full names
           $x = "abc\N{MERCURY}def";
           $x =~ /\N{MERCURY}/;   # matches

       One can also use short names or restrict names to a cer­
       tain alphabet:

           use charnames ':full';
           print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";

           use charnames ":short";
           print "\N{greek:Sigma} is an upper-case sigma.\n";

           use charnames qw(greek);
           print "\N{sigma} is Greek sigma\n";

       A list of full names is found in the file Names.txt in the
       lib/perl5/5.X.X/unicore directory.

           $x = "\N{MERCURY}";  # two-byte Unicode character
           $x =~ /\C/;  # matches, but dangerous!

       The last regexp matches, but is dangerous because the
       string character position is no longer synchronized to the
       string byte position.  This generates the warning 'Mal­
       formed UTF-8 character'.  The "\C" is best used for match­
       ing the binary data in strings with binary data intermixed
       with Unicode characters.

       Let us now discuss the rest of the character classes.
       Just as with Unicode characters, there are named Unicode
       character classes represented by the "\p{name}" escape
       sequence.  Closely associated is the "\P{name}" character
       class, which is the negation of the "\p{name}" class.  For
       example, to match lower and uppercase characters,

           use charnames ":full"; # use named chars with Unicode full names
           $x = "BOB";
           $x =~ /^\p{IsUpper}/;   # matches, uppercase char class
           $x =~ /^\P{IsUpper}/;   # doesn't match, char class sans uppercase
           $x =~ /^\p{IsLower}/;   # doesn't match, lowercase char class
           $x =~ /^\P{IsLower}/;   # matches, char class sans lowercase

       Here is the association between some Perl named classes
       and the traditional Unicode classes:

           Perl class name  Unicode class name or regular expression

           IsAlpha          /^[LM]/
           IsAlnum          /^[LMN]/
           IsASCII          $code <= 127
           IsCntrl          /^C/
           IsBlank          $code =~ /^(0020|0009)$/ || /^Z[^lp]/
           IsDigit          Nd
           IsGraph          /^([LMNPS]|Co)/
           IsLower          Ll
           IsPrint          /^([LMNPS]|Co|Zs)/
           IsPunct          /^P/
           IsSpace          /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
           IsSpacePerl      /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
           IsUpper          /^L[ut]/
           IsWord           /^[LMN]/ || $code eq "005F"
           IsXDigit         $code =~ /^00(3[0-9]|[46][1-6])$/

       You can also use the official Unicode class names with the
       "\p" and "\P", like "\p{L}" for Unicode 'letters', or
       "\p{Lu}" for uppercase letters, or "\P{Nd}" for non-dig­
       its.  If a "name" is just one letter, the braces can be
       dropped.  For instance, "\pM" is the character class of
       Unicode 'marks', for example accent marks.  For the full
       list see perlunicode.
       character "COMBINING RING" , which translates in Danish to
       A with the circle atop it, as in the word Angstrom.  "\X"
       is equivalent to "\PM\pM*}", i.e., a non-mark followed by
       one or more marks.

       For the full and latest information about Unicode see the
       latest Unicode standard, or the Unicode Consortium's web­
       site http://www.unicode.org/

       As if all those classes weren't enough, Perl also defines
       POSIX style character classes.  These have the form
       "[:name:]", with "name" the name of the POSIX class.  The
       POSIX classes are "alpha", "alnum", "ascii", "cntrl",
       "digit", "graph", "lower", "print", "punct", "space",
       "upper", and "xdigit", and two extensions, "word" (a Perl
       extension to match "\w"), and "blank" (a GNU extension).
       If "utf8" is being used, then these classes are defined
       the same as their corresponding perl Unicode classes:
       "[:upper:]" is the same as "\p{IsUpper}", etc.  The POSIX
       character classes, however, don't require using "utf8".
       The "[:digit:]", "[:word:]", and "[:space:]" correspond to
       the familiar "\d", "\w", and "\s" character classes.  To
       negate a POSIX class, put a "^" in front of the name, so
       that, e.g., "[:^digit:]" corresponds to "\D" and under
       "utf8", "\P{IsDigit}".  The Unicode and POSIX character
       classes can be used just like "\d", with the exception
       that POSIX character classes can only be used inside of a
       character class:

           /\s+[abc[:digit:]xyz]\s*/;  # match a,b,c,x,y,z, or a digit
           /^=item\s[[:digit:]]/;      # match '=item',
                                       # followed by a space and a digit
           use charnames ":full";
           /\s+[abc\p{IsDigit}xyz]\s+/;  # match a,b,c,x,y,z, or a digit
           /^=item\s\p{IsDigit}/;        # match '=item',
                                         # followed by a space and a digit

       Whew! That is all the rest of the characters and character
       classes.

       Compiling and saving regular expressions

       In Part 1 we discussed the "//o" modifier, which compiles
       a regexp just once.  This suggests that a compiled regexp
       is some data structure that can be stored once and used
       again and again.  The regexp quote "qr//" does exactly
       that: "qr/string/" compiles the "string" as a regexp and
       transforms the result into a form that can be assigned to
       a variable:

           $reg = qr/foo+bar?/;  # reg contains a compiled regexp


       Pre-compiled regexps are useful for creating dynamic
       matches that don't need to be recompiled each time they
       are encountered.  Using pre-compiled regexps, "sim­
       ple_grep" program can be expanded into a program that
       matches multiple patterns:

           % cat > multi_grep
           #!/usr/bin/perl
           # multi_grep - match any of <number> regexps
           # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...

           $number = shift;
           $regexp[$_] = shift foreach (0..$number-1);
           @compiled = map qr/$_/, @regexp;
           while ($line = <>) {
               foreach $pattern (@compiled) {
                   if ($line =~ /$pattern/) {
                       print $line;
                       last;  # we matched, so move onto the next line
                   }
               }
           }
           ^D

           % multi_grep 2 last for multi_grep
               $regexp[$_] = shift foreach (0..$number-1);
                   foreach $pattern (@compiled) {
                           last;

       Storing pre-compiled regexps in an array @compiled allows
       us to simply loop through the regexps without any recompi­
       lation, thus gaining flexibility without sacrificing
       speed.

       Embedding comments and modifiers in a regular expression

       Starting with this section, we will be discussing Perl's
       set of extended patterns.  These are extensions to the
       traditional regular expression syntax that provide power­
       ful new tools for pattern matching.  We have already seen
       extensions in the form of the minimal matching constructs
       "??", "*?", "+?", "{n,m}?", and "{n,}?".  The rest of the
       extensions below have the form "(?char...)", where the
       "char" is a character that determines the type of exten­
       sion.

       The first extension is an embedded comment "(?#text)".
       This embeds a comment into the regular expression without
       affecting its meaning.  The comment should not have any
       closing parentheses in the text.  An example is

                    \d+    # match a sequence of digits
                )
           /x;

       Embedded modifiers can have two important advantages over
       the usual modifiers.  Embedded modifiers allow a custom
       set of modifiers to each regexp pattern.  This is great
       for matching an array of regexps that must have different
       modifiers:

           $pattern[0] = '(?i)doctor';
           $pattern[1] = 'Johnson';
           ...
           while (<>) {
               foreach $patt (@pattern) {
                   print if /$patt/;
               }
           }

       The second advantage is that embedded modifiers only
       affect the regexp inside the group the embedded modifier
       is contained in.  So grouping can be used to localize the
       modifier's effects:

           /Answer: ((?i)yes)/;  # matches 'Answer: yes', 'Answer: YES', etc.

       Embedded modifiers can also turn off any modifiers already
       present by using, e.g., "(?-i)".  Modifiers can also be
       combined into a single expression, e.g., "(?s-i)" turns on
       single line mode and turns off case insensitivity.

       Non-capturing groupings

       We noted in Part 1 that groupings "()" had two distinct
       functions: 1) group regexp elements together as a single
       unit, and 2) extract, or capture, substrings that matched
       the regexp in the grouping.  Non-capturing groupings,
       denoted by "(?:regexp)", allow the regexp to be treated as
       a single unit, but don't extract substrings or set match­
       ing variables $1, etc.  Both capturing and non-capturing
       groupings are allowed to co-exist in the same regexp.
       Because there is no extraction, non-capturing groupings
       are faster than capturing groupings.  Non-capturing group­
       ings are also handy for choosing exactly which parts of a
       regexp are to be extracted to matching variables:

           # match a number, $1-$4 are set, but we only want $1
           /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;

           # match a number faster , only $1 is set
           /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;


       Looking ahead and looking behind

       This section concerns the lookahead and lookbehind asser­
       tions.  First, a little background.

       In Perl regular expressions, most regexp elements 'eat up'
       a certain amount of string when they match.  For instance,
       the regexp element "[abc}]" eats up one character of the
       string when it matches, in the sense that perl moves to
       the next character position in the string after the match.
       There are some elements, however, that don't eat up char­
       acters (advance the character position) if they match.
       The examples we have seen so far are the anchors.  The
       anchor "^" matches the beginning of the line, but doesn't
       eat any characters.  Similarly, the word boundary anchor
       "\b" matches, e.g., if the character to the left is a word
       character and the character to the right is a non-word
       character, but it doesn't eat up any characters itself.
       Anchors are examples of 'zero-width assertions'.
       Zero-width, because they consume no characters, and asser­
       tions, because they test some property of the string.  In
       the context of our walk in the woods analogy to regexp
       matching, most regexp elements move us along a trail, but
       anchors have us stop a moment and check our surroundings.
       If the local environment checks out, we can proceed for­
       ward.  But if the local environment doesn't satisfy us, we
       must backtrack.

       Checking the environment entails either looking ahead on
       the trail, looking behind, or both.  "^" looks behind, to
       see that there are no characters before.  "$" looks ahead,
       to see that there are no characters after.  "\b" looks
       both ahead and behind, to see if the characters on either
       side differ in their 'word'-ness.

       The lookahead and lookbehind assertions are generaliza­
       tions of the anchor concept.  Lookahead and lookbehind are
       zero-width assertions that let us specify which characters
       we want to test for.  The lookahead assertion is denoted
       by "(?=regexp)" and the lookbehind assertion is denoted by
       "(?<=fixed-regexp)".  Some examples are

           $x = "I catch the housecat 'Tom-cat' with catnip";
           $x =~ /cat(?=\s+)/;  # matches 'cat' in 'housecat'
           @catwords = ($x =~ /(?<=\s)cat\w+/g);  # matches,
                                                  # $catwords[0] = 'catch'
                                                  # $catwords[1] = 'catnip'
           $x =~ /\bcat\b/;  # matches 'cat' in 'Tom-cat'
           $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
                                     # middle of $x

           $x =~ /foo(?!bar)/;  # doesn't match, 'bar' follows 'foo'
           $x =~ /foo(?!baz)/;  # matches, 'baz' doesn't follow 'foo'
           $x =~ /(?<!\s)foo/;  # matches, there is no \s before 'foo'

       The "\C" is unsupported in lookbehind, because the already
       treacherous definition of "\C" would become even more so
       when going backwards.

       Using independent subexpressions to prevent backtracking

       The last few extended patterns in this tutorial are exper­
       imental as of 5.6.0.  Play with them, use them in some
       code, but don't rely on them just yet for production code.

       Independent subexpressions  are regular expressions, in
       the context of a larger regular expression, that function
       independently of the larger regular expression.  That is,
       they consume as much or as little of the string as they
       wish without regard for the ability of the larger regexp
       to match.  Independent subexpressions are represented by
       "(?>regexp)".  We can illustrate their behavior by first
       considering an ordinary regexp:

           $x = "ab";
           $x =~ /a*ab/;  # matches

       This obviously matches, but in the process of matching,
       the subexpression "a*" first grabbed the "a".  Doing so,
       however, wouldn't allow the whole regexp to match, so
       after backtracking, "a*" eventually gave back the "a" and
       matched the empty string.  Here, what "a*" matched was
       dependent on what the rest of the regexp matched.

       Contrast that with an independent subexpression:

           $x =~ /(?>a*)ab/;  # doesn't match!

       The independent subexpression "(?>a*)" doesn't care about
       the rest of the regexp, so it sees an "a" and grabs it.
       Then the rest of the regexp "ab" cannot match.  Because
       "(?>a*)" is independent, there is no backtracking and the
       independent subexpression does not give up its "a".  Thus
       the match of the regexp as a whole fails.  A similar
       behavior occurs with completely independent regexps:

           $x = "ab";
           $x =~ /a*/g;   # matches, eats an 'a'
           $x =~ /\Gab/g; # doesn't match, no 'a' available

       Here "//g" and "\G" create a 'tag team' handoff of the
       string from one regexp to the other.  Regexps with an
       independent subexpression are much like this, with a hand­
       matching a substring with no parentheses and the second
       alternative "\([^()]*\)"  matching a substring delimited
       by parentheses.  The problem with this regexp is that it
       is pathological: it has nested indeterminate quantifiers
       of the form "(a+|b)+".  We discussed in Part 1 how nested
       quantifiers like this could take an exponentially long
       time to execute if there was no match possible.  To pre­
       vent the exponential blowup, we need to prevent useless
       backtracking at some point.  This can be done by enclosing
       the inner quantifier as an independent subexpression:

           $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;

       Here, "(?>[^()]+)" breaks the degeneracy of string parti­
       tioning by gobbling up as much of the string as possible
       and keeping it.   Then match failures fail much more
       quickly.

       Conditional expressions

       A conditional expression  is a form of if-then-else state­
       ment that allows one to choose which patterns are to be
       matched, based on some condition.  There are two types of
       conditional expression: "(?(condition)yes-regexp)" and
       "(?(condition)yes-regexp|no-regexp)".  "(?(condi­
       tion)yes-regexp)" is like an 'if () {}'  statement in
       Perl.  If the "condition" is true, the "yes-regexp" will
       be matched.  If the "condition" is false, the "yes-regexp"
       will be skipped and perl will move onto the next regexp
       element.  The second form is like an 'if () {} else {}'
       statement in Perl.  If the "condition" is true, the
       "yes-regexp" will be matched, otherwise the "no-regexp"
       will be matched.

       The "condition" can have two forms.  The first form is
       simply an integer in parentheses "(integer)".  It is true
       if the corresponding backreference "\integer" matched ear­
       lier in the regexp.  The second form is a bare zero width
       assertion "(?...)", either a lookahead, a lookbehind, or a
       code assertion (discussed in the next section).

       The integer form of the "condition" allows us to choose,
       with more flexibility, what to match based on what matched
       earlier in the regexp. This searches for words of the form
       "$x$x" or "$x$y$y$x":

           % simple_grep '^(\w+)(\w+)?(?(2)\2\1|\1)$' /usr/dict/words
           beriberi
           coco
           couscous
           deed
           ...

       theses around the conditional are not needed.

       A bit of magic: executing Perl code in a regular expres­
       sion

       Normally, regexps are a part of Perl expressions.
       Code evaluation  expressions turn that around by allowing
       arbitrary Perl code to be a part of a regexp.  A code
       evaluation expression is denoted "(?{code})", with "code"
       a string of Perl statements.

       Code expressions are zero-width assertions, and the value
       they return depends on their environment.  There are two
       possibilities: either the code expression is used as a
       conditional in a conditional expression "(?(condi­
       tion)...)", or it is not.  If the code expression is a
       conditional, the code is evaluated and the result (i.e.,
       the result of the last statement) is used to determine
       truth or falsehood.  If the code expression is not used as
       a conditional, the assertion always evaluates true and the
       result is put into the special variable $^R.  The variable
       $^R can then be used in code expressions later in the reg­
       exp.  Here are some silly examples:

           $x = "abcdef";
           $x =~ /abc(?{print "Hi Mom!";})def/; # matches,
                                                # prints 'Hi Mom!'
           $x =~ /aaa(?{print "Hi Mom!";})def/; # doesn't match,
                                                # no 'Hi Mom!'

       Pay careful attention to the next example:

           $x =~ /abc(?{print "Hi Mom!";})ddd/; # doesn't match,
                                                # no 'Hi Mom!'
                                                # but why not?

       At first glance, you'd think that it shouldn't print,
       because obviously the "ddd" isn't going to match the tar­
       get string. But look at this example:

           $x =~ /abc(?{print "Hi Mom!";})[d]dd/; # doesn't match,
                                                  # but _does_ print

       Hmm. What happened here? If you've been following along,
       you know that the above pattern should be effectively the
       same as the last one -- enclosing the d in a character
       class isn't going to change what it matches. So why does
       the first not print while the second one does?

       The answer lies in the optimizations the REx engine makes.
       In the first case, all the engine sees are plain old char­
       acters (aside from the "?{}" construct). It's smart enough

           $x =~ /(?{print "Hi Mom!";})/;       # matches,
                                                # prints 'Hi Mom!'
           $x =~ /(?{$c = 1;})(?{print "$c";})/;  # matches,
                                                  # prints '1'
           $x =~ /(?{$c = 1;})(?{print "$^R";})/; # matches,
                                                  # prints '1'

       The bit of magic mentioned in the section title occurs
       when the regexp backtracks in the process of searching for
       a match.  If the regexp backtracks over a code expression
       and if the variables used within are localized using
       "local", the changes in the variables produced by the code
       expression are undone! Thus, if we wanted to count how
       many times a character got matched inside a group, we
       could use, e.g.,

           $x = "aaaa";
           $count = 0;  # initialize 'a' count
           $c = "bob";  # test if $c gets clobbered
           $x =~ /(?{local $c = 0;})         # initialize count
                  ( a                        # match 'a'
                    (?{local $c = $c + 1;})  # increment count
                  )*                         # do this any number of times,
                  aa                         # but match 'aa' at the end
                  (?{$count = $c;})          # copy local $c var into $count
                 /x;
           print "'a' count is $count, \$c variable is '$c'\n";

       This prints

           'a' count is 2, $c variable is 'bob'

       If we replace the " (?{local $c = $c + 1;})"  with
       " (?{$c = $c + 1;})" , the variable changes are not undone
       during backtracking, and we get

           'a' count is 4, $c variable is 'bob'

       Note that only localized variable changes are undone.
       Other side effects of code expression execution are perma­
       nent.  Thus

           $x = "aaaa";
           $x =~ /(a(?{print "Yow\n";}))*aa/;

       produces

          Yow
          Yow
          Yow
          Yow
                              the |             # if so, then match 'the'
                              (die|das|der)     # else, match 'die|das|der'
                            )
                           /xi;

       Note that the syntax here is "(?(?{...})yes-regexp|no-reg­
       exp)", not "(?((?{...}))yes-regexp|no-regexp)".  In other
       words, in the case of a code expression, we don't need the
       extra parentheses around the conditional.

       If you try to use code expressions with interpolating
       variables, perl may surprise you:

           $bar = 5;
           $pat = '(?{ 1 })';
           /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
           /foo(?{ 1 })$bar/;   # compile error!
           /foo${pat}bar/;      # compile error!

           $pat = qr/(?{ $foo = 1 })/;  # precompile code regexp
           /foo${pat}bar/;      # compiles ok

       If a regexp has (1) code expressions and interpolating
       variables,or (2) a variable that interpolates a code
       expression, perl treats the regexp as an error. If the
       code expression is precompiled into a variable, however,
       interpolating is ok. The question is, why is this an
       error?

       The reason is that variable interpolation and code expres­
       sions together pose a security risk.  The combination is
       dangerous because many programmers who write search
       engines often take user input and plug it directly into a
       regexp:

           $regexp = <>;       # read user-supplied regexp
           $chomp $regexp;     # get rid of possible newline
           $text =~ /$regexp/; # search $text for the $regexp

       If the $regexp variable contains a code expression, the
       user could then execute arbitrary Perl code.  For
       instance, some joker could search for "sys­
       tem('rm -rf *');"  to erase your files.  In this sense,
       the combination of interpolation and code expressions
       taints your regexp.  So by default, using both interpola­
       tion and code expressions in the same regexp is not
       allowed.  If you're not concerned about malicious users,
       it is possible to bypass this security check by invoking
       "use re 'eval'" :

           use re 'eval';       # throw caution out the door
           $bar = 5;

       This final example contains both ordinary and pattern code
       expressions.   It detects if a binary string
       1101010010001... has a Fibonacci spacing 0,1,1,2,3,5,...
       of the 1's:

           $s0 = 0; $s1 = 1; # initial conditions
           $x = "1101010010001000001";
           print "It is a Fibonacci sequence\n"
               if $x =~ /^1         # match an initial '1'
                           (
                              (??{'0' x $s0}) # match $s0 of '0'
                              1               # and then a '1'
                              (?{
                                 $largest = $s0;   # largest seq so far
                                 $s2 = $s1 + $s0;  # compute next term
                                 $s0 = $s1;        # in Fibonacci sequence
                                 $s1 = $s2;
                                })
                           )+   # repeat as needed
                         $      # that is all there is
                        /x;
           print "Largest sequence matched was $largest\n";

       This prints

           It is a Fibonacci sequence
           Largest sequence matched was 5

       Ha! Try that with your garden variety regexp package...

       Note that the variables $s0 and $s1 are not substituted
       when the regexp is compiled, as happens for ordinary vari­
       ables outside a code expression.  Rather, the code expres­
       sions are evaluated when perl encounters them during the
       search for a match.

       The regexp without the "//x" modifier is

           /^1((??{'0'x$s0})1(?{$largest=$s0;$s2=$s1+$s0$s0=$s1;$s1=$s2;}))+$/;

       and is a great start on an Obfuscated Perl entry :-) When
       working with code and conditional expressions, the
       extended form of regexps is almost necessary in creating
       and debugging regexps.

       Pragmas and debugging

       Speaking of debugging, there are several pragmas available
       to control and debug regexps in Perl.  We have already
       encountered one pragma in the previous section,
       "use re 'eval';" , that allows variable interpolation and
       until the end of the block enclosing the pragmas.

           use re 'debug';
           /^(.*)$/s;       # output debugging info

           use re 'debugcolor';
           /^(.*)$/s;       # output debugging info in living color

       The global "debug" and "debugcolor" pragmas allow one to
       get detailed debugging info about regexp compilation and
       execution.  "debugcolor" is the same as debug, except the
       debugging information is displayed in color on terminals
       that can display termcap color sequences.  Here is example
       output:

           % perl -e 'use re "debug"; "abc" =~ /a*b+c/;'
           Compiling REx `a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)
              9: END(0)
           floating `bc' at 0..2147483647 (checking floating) minlen 2
           Guessing start of match, REx `a*b+c' against `abc'...
           Found floating substr `bc' at offset 1...
           Guessed: match at offset 0
           Matching REx `a*b+c' against `abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>             |  1:  STAR
                                      EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>             |  4:    PLUS
                                      EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>             |  7:      EXACT <c>
              3 <abc> <>             |  9:      END
           Match successful!
           Freeing REx: `a*b+c'

       If you have gotten this far into the tutorial, you can
       probably guess what the different parts of the debugging
       output tell you.  The first part

           Compiling REx `a*b+c'
           size 9 first at 1
              1: STAR(4)
              2:   EXACT <a>(0)
              4: PLUS(7)
              5:   EXACT <b>(0)
              7: EXACT <c>(9)

       describe the process:

           Matching REx `a*b+c' against `abc'
             Setting an EVAL scope, savestack=3
              0 <> <abc>             |  1:  STAR
                                      EXACT <a> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              1 <a> <bc>             |  4:    PLUS
                                      EXACT <b> can match 1 times out of 32767...
             Setting an EVAL scope, savestack=3
              2 <ab> <c>             |  7:      EXACT <c>
              3 <abc> <>             |  9:      END
           Match successful!
           Freeing REx: `a*b+c'

       Each step is of the form "n <x> <y>" , with "<x>" the part
       of the string matched and "<y>" the part not yet matched.
       The "| 1: STAR"  says that perl is at line number 1 n the
       compilation list above.  See "Debugging regular expres­
       sions" in perldebguts for much more detail.

       An alternative method of debugging regexps is to embed
       "print" statements within the regexp.  This provides a
       blow-by-blow account of the backtracking in an alterna­
       tion:

           "that this" =~ m@(?{print "Start at position ", pos, "\n";})
                            t(?{print "t1\n";})
                            h(?{print "h1\n";})
                            i(?{print "i1\n";})
                            s(?{print "s1\n";})
                                |
                            t(?{print "t2\n";})
                            h(?{print "h2\n";})
                            a(?{print "a2\n";})
                            t(?{print "t2\n";})
                            (?{print "Done at position ", pos, "\n";})
                           @x;

       prints

           Start at position 0
           t1
           h1
           t2
           h2
           a2
           t2
           Done at position 4


BUGS

       Code expressions, conditional expressions, and independent
       ing of regular expressions, see the book Mastering Regular
       Expressions by Jeffrey Friedl (published by O'Reilly, ISBN
       1556592-257-3).


AUTHOR AND COPYRIGHT

       Copyright (c) 2000 Mark Kvale All rights reserved.

       This document may be distributed under the same terms as
       Perl itself.

       Acknowledgments

       The inspiration for the stop codon DNA example came from
       the ZIP code example in chapter 7 of Mastering Regular
       Expressions.

       The author would like to thank Jeff Pinyan, Andrew John­
       son, Peter Haworth, Ronald J Kimball, and Joe Smith for
       all their helpful comments.

perl v5.8.1                 2003-09-02               PERLRETUT(1)
  

More information about the site can be found in the FAQ


Login
Nickname

Password

Security Code
Security Code
Type Security Code


Don't have an account yet? You can create one. As a registered user you have some advantages like theme manager, comments configuration and post comments with your name.

Help if you can!


Amazon Wish List

Did You Know?
You can help in many different ways.


Friends



Tell a Friend About Us

Bookmark and Share



Web site powered by PHP-Nuke

Is this information useful? At the very least you can help by spreading the word to your favorite newsgroups, mailing lists and forums.
All logos and trademarks in this site are property of their respective owner. The comments are property of their posters. Articles are the property of their respective owners. Unless otherwise stated in the body of the article, article content (C) 1994-2013 by James Mohr. All rights reserved. The stylized page/paper, as well as the terms "The Linux Tutorial", "The Linux Server Tutorial", "The Linux Knowledge Base and Tutorial" and "The place where you learn Linux" are service marks of James Mohr. All rights reserved.
The Linux Knowledge Base and Tutorial may contain links to sites on the Internet, which are owned and operated by third parties. The Linux Tutorial is not responsible for the content of any such third-party site. By viewing/utilizing this web site, you have agreed to our disclaimer, terms of use and privacy policy. Use of automated download software ("harvesters") such as wget, httrack, etc. causes the site to quickly exceed its bandwidth limitation and are therefore expressly prohibited. For more details on this, take a look here

PHP-Nuke Copyright © 2004 by Francisco Burzi. This is free software, and you may redistribute it under the GPL. PHP-Nuke comes with absolutely no warranty, for details, see the license.
Page Generation: 0.20 Seconds